Helianthus annuus

  1. HaT13l026594 Haem peroxidase

HaT13l026594
Permalink : http://www.heliagene.org/HaT13l?clusterid=HaT13l026594
Peptides
Peptides
Peptides PeptidesExpression FASTA Multalin
Multalin
ID HaT13l026594
AC HaT13l026594
IP Haem peroxidase
GO Biological Process: oxidation-reduction process (GO:0055114)
Biological Process: response to oxidative stress (GO:0006979)
Molecular Function: heme binding (GO:0020037)
Molecular Function: peroxidase activity (GO:0004601)
CC
LN 1302 nt
SQ
........10........20........30........40........50
| | | | |
TGAGCGGGAAATTGTATGAAAGATGTCGTCCATCACTGGCTTCAACTTCA
ACCTCTCGTTCCGGCATCTATACATACAATTTCCCGCTCAATCTCGCCGG
AAAATCGAGTACGGCTGCACCTGCACCGCCGTTAGACCCGTCCTTTGTTC
CACGTCATCATCCGTTTCTCATTCAGATGAGAATCATGTTAGCACTTCAT
ATAGCAGGAGATTGATGACTTTTATGATCACATTTCTTTTGCCTCTGCCT
AAATCAATACAACTTTCTGGTGCCGATGCGTATGCTGCTGCAGATGATCT
AGTCTTAGTACAGGAAGAGATAAGAAAAGTATTATCCAAGAGTAAAGCCG
CTGGTGTTCTTCGCTTGGTTTTTCATGACGCAGGAACCTACGAAATGGAT
GATGATTCGGGTGGCATGAATGGCTCCATATCTTTTGAACTCGATAGACC
CGAAAACAAAGGTCTTAAGAAATCATTGAAGATTCTGGTGGAAGCTAAAA
AGATGGTGGACGAGAAACAGCCAGTGTCAATGGCTGATATGATTGCTGTG
GCTGGAGCCGAAGCCGTCTCTTTATGCGGAGGTCCAAAAATCCCCGTTCG
CTTAGGCAGATTAGACTCGATGGTACCTGACCCCGAGGGAAAACTTCCGG
AAGAAACGTTAGATGCCTCTGGATTAAAACAAAGTTTTCAACGAAAAGGT
TTTTCAACACAAGAACTTGTAGCATTATCTGGTGCGCATACTCTTGGAAG
CAAAGGTTTTGGAAATCCGGTTATTTTCAATAATGCGTATTACAAAGTCC
TGTTGGAGAAGCCATGGCTATCTTCGGCTGGAATGACAAGTATGGTCGGT
CTTCCTTCTGATCGTGCTCTAGTTGATGACGATGAATGCTTAAGGTGGAT
CTCAAAGTATGCTGATGATCAAGATTTGTTCTTTGAAGATTTCAAGAATG
CTTATATCAAACTTGTGAATTCTGGTGCAAAATGGAGAAGGGATTCTTAG
TTTTCCTGTTTTATATATTTTGTCAATACTGAGAGATGTTTTCAACAACT
ATTTTAATCAGTATGAACCGGCTGGTTATACCGGTTAAACCGGATATCGG
ACACAAGTCCGGTACGATAAAGGCCGGTAAAATCTGAATATGGTATGTCT
TATGTACCGGCGGTAAATCCGGTTCTACCGTTCAAACCGTTGAACCGGTT
TGCATTTTCTTAAGATTTGATTTCTTAATTTTAATAAAATACGATGTTAA
GGTAATACTGCCTTGCATTCCAATATGCATCGCTGTTGGAATTGTTACCC
GC
HELAN

HaT13l011734

1061

1260

S=153 I=93.6 E=3.00978e-63

chr= IPR005202:Transcription factor GRAS;

HELAN

HELAN

HaT13l066638

1061

1233

S=115 I=83.24 E=4.06576e-45

chr=

HELAN

HELAN

HaT13l067159

1061

1232

S=113 I=89.2 E=3.65918e-44

chr= IPR005202:Transcription factor GRAS;

HELAN

HELAN

HaT13l038906

1078

1257

S=109 I=84.78 E=2.96394e-42

chr= IPR005202:Transcription factor GRAS;

HELAN

HELAN

HaT13l067034

703

825

S=103 I=91.87 E=2.16071e-39

chr=

HELAN

HELAN

HaT13l119046

1061

1219

S=88 I=83.65 E=3.10038e-32

chr=

HELAN

HELAN

HaT13l008857

1081

1213

S=78 I=81.62 E=1.83075e-27

chr= IPR016024:Armadillo-type fold;

HELAN

HELAN

HaT13l053314

1081

1155

S=53 I=85.33 E=1.55117e-15

chr=

HELAN

HELAN

HaT13l093189

678

747

S=38 I=77.14 E=2.22576e-08

chr= IPR010255:Haem peroxidase;

HELAN

HELAN

HaT13l066779

1056

1131

S=36 I=73.68 E=2.00318e-07

chr=

HELAN

HELAN

HaT13l009233

1056

1180

S=35 I=66.4 E=6.00955e-07

chr= IPR001372:Dynein light chain, type 1/2;

HELAN

HELAN

HuCL19434C001

313

1058

S=706 I=98.66 E=0

IPR002207:Plant ascorbate peroxidase; IPR010255:Haem peroxidase;

HELAN

HuEL446206

1061

1257

S=133 I=91.96 E=2.40898e-69

AT4G32320.1

305

985

S=940 I=77.53 E=3.27365e-106

symbols:APX6; ascorbate peroxidase 6

AT3G09640.2

329

976

S=357 I=39.04 E=1.43242e-35

symbols:APX2,APX1B; ascorbate peroxidase 2

AT3G09640.1

329

976

S=357 I=39.04 E=1.43242e-35

symbols:APX2,APX1B; ascorbate peroxidase 2

AT4G35970.1

311

976

S=322 I=38.14 E=2.49434e-31

symbols:APX5; ascorbate peroxidase 5

AT1G07890.8

311

976

S=322 I=35.32 E=2.49434e-31

symbols:APX1,MEE6,CS1,ATAPX1,ATAPX01; ascorbate peroxidase 1

sp

sp|Q8GY91|APX6_ARATH

305

985

S=940 I=77.53 E=3.76105e-105

Putative L-ascorbate peroxidase 6 EC=1.11.1.11 ; Heme Hydrogen peroxide Iron Metal-binding Oxidoreductase Reference proteome

 

prodomImg

sp

sp|Q1PER6|APX2_ARATH

329

976

S=357 I=39.04 E=1.64569e-34

L-ascorbate peroxidase 2, cytosolic EC=1.11.1.11 ; Calcium Cytoplasm Heme Hydrogen peroxide Iron Metal-binding Oxidoreductase Potassium Referen

 

prodomImg

sp

sp|A4R606|CCPR2_MAGO7

356

982

S=335 I=37.6 E=7.62161e-32

Putative heme-binding peroxidase EC=1.11.1.- ; Iron Metal-binding Oxidoreductase

 

prodomImg

sp

sp|Q0JEQ2|APX3_ORYSJ

329

976

S=333 I=38.86 E=1.33163e-31

Probable L-ascorbate peroxidase 3 EC=1.11.1.11 ; Calcium Heme Hydrogen peroxide Iron Membrane Metal-binding Oxidoreductase Potassium Transmem

 

prodomImg

sp

sp|A2XFC7|APX1_ORYSI

311

976

S=333 I=37.29 E=1.33163e-31

L-ascorbate peroxidase 1, cytosolic EC=1.11.1.11 ; Calcium Cytoplasm Heme Hydrogen peroxide Iron Metal-binding Oxidoreductase Potassium Stres

 

prodomImg

pubmed

329

976

S=357 I=39.04 E=2.73906e-34

L-ascorbate peroxidase 2, cytosolic EC=1.11.1.11 ; Calcium Cytoplasm Heme Hydrogen peroxide Iron Metal-binding Oxidoreductase Potassium Referen

Pubmed 8580771,9144965

 

prodomImg

pubmed

356

985

S=351 I=37.17 E=1.46087e-33

Ascorbate peroxidase

Pubmed 17899175

 

prodomImg

pubmed

311

976

S=339 I=37.55 E=4.15556e-32

Ascorbate peroxidase

Pubmed 16850189

 

prodomImg

pubmed

311

976

S=338 I=38.72 E=5.49284e-32

Ascorbate peroxidase

Pubmed 17041024

 

prodomImg

pubmed

329

976

S=335 I=37.44 E=1.26853e-31

Peroxisome type ascorbate peroxidase

Pubmed 11483357

 

prodomImg

Show or not Suggestions

Suggest an annotation

Definition

Evidence

  Your email
  Validation code (copy this one jufRFTWN)
   

members Access unfiltered results
sp

Swiss-Prot database release 2111214

HP200907Clusters

Helianthus + Plasmopara 2009 clusters

LACSATranscripts

Lactuca sativa transcripts from NCBI NUCEST transcripts (release 20120126)

HuSep2007Clusters

HeliaGene 2008 clusters

tair

Arabidopsis thaliana proteome TAIR10

HELANClusters

Helianthus annuus Clusters database ncbi-blastn analyses

pubmed

PubMed proteins (TrEMBL subset, release 2111214)